 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_102485 | |||
| Gene | PGPEP1 | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Primary Biliary Cholangitis | ICD-10 | Cholangitis (K83.0) |
| DBLink | Link to database | PMID | 29183005 |
| Experimental Method | |||
| Sample Type | Plasma sample | Comparison | 6 Primary Biliary Cholangitis (PBC) patients and 6 healthy controls |
| Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
| Primers (Experimented) | Forward TGTGTACGAGATTCCGGTTGAGT ReverseCGAGGTGGAAGGATCATTTGAG | Statistics | Fold Change : Upregulated,1.554524 pvalue : p=0.03233656 |
| Citation | |||
| Zheng, J, Li, Z, Wang, T, Zhao, Y, Wang, Y (2017). Microarray Expression Profile of Circular RNAs in Plasma from Primary Biliary Cholangitis Patients. Cell. Physiol. Biochem., 44, 4:1271-1281. | |||